Sequence ID | >C161104331 |
Genome ID | FR745875 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium botulinum B str. Eklund 17B [NRP] [FR745875] |
Start position on genome | 1852455 |
End posion on genome | 1852381 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaaaatctat |
tRNA gene sequence |
GGCACTATAGCCAAGCGGTAAGGCAGAGGTCTGCAAAACCTTTATTCCCCAGTTCAAATC |
Downstream region at tRNA end position |
ctaaagaaag |
Secondary structure (Cloverleaf model) | >C161104331 Cys GCA t TCCA ctaaagaaag G - C G - C C - G A - T C - G T + G A - T T A T G G G T C A G A A | | | | | A C A C C G C C C A G C G | | | T T G A G G C T A A TATTC G + T A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |