| Sequence ID | >C161106761 |
| Genome ID | LN868200 |
| Phylum/Class | Gammaproteobacteria |
| Species | Acinetobacter baumannii [LN868200] |
| Start position on genome | 2142156 |
| End posion on genome | 2142232 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
tctgattata |
| tRNA gene sequence |
GGGCCTATAGCTCAGTCGGTTAGAGCAGCGGACTCATAATCCGTTGGTCCACAGTTCGAG |
| Downstream region at tRNA end position |
aatacaaacc |
| Secondary structure (Cloverleaf model) | >C161106761 Met CAT
a ACCA aatacaaacc
G - C
G - C
G - C
C - G
C - G
T + G
A - T T G
T G T G T C A
T G A A | | | | | G
C C T C G C A C A G C
G | | | | T T
G G A G C
T T A A TGGTC
G + T
C - G
G - C
G - C
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |