Sequence ID | >W121067711 |
Genome ID | AJTM01000051 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium longum subsp. longum 44B [AJTM] |
Start position on genome | 85359 |
End posion on genome | 85288 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
agcccacgac |
tRNA gene sequence |
TCCCCCATGGTGTAATGGCAGCACACGGGTCTTTGGAACCCTTTGTCTTGGTTCGAGTCC |
Downstream region at tRNA end position |
ctgacggccg |
Secondary structure (Cloverleaf model) | >W121067711 Gln TTG c ACgg ctgacggccg T - A C - G C - G C - G C - G C - G A - T T G T G G A C C A A A G | + | | | G T T G T G C T T G G C G + | | | T T G G C A C C A A TTGT C T G - C G - C G - C T - A C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |