Sequence ID | >W121079666 |
Genome ID | AKEH01000082 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas phaseoli pv. manihotis str. ORST17 [AKEH] |
Start position on genome | 250 |
End posion on genome | 177 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
agttcccggc |
tRNA gene sequence |
GCGGGAGTAGTTCAACGGTAGAACCTCAGCCTTCCAAGCTGATGGTGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ttgaacgcga |
Secondary structure (Cloverleaf model) | >W121079666 Gly TCC c TCCA ttgaacgcga G - C C - G G - C G - C G - C A - T G - C T T T T G C C C A A A A + | | | | G C C T T G G C G G G C G | | | | T T G G A A C T A C TGGT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |