Sequence ID | >W121065623 |
Genome ID | AJQE01000139 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Bradyrhizobium sp. CCBAU 43298 [AJQE] |
Start position on genome | 1924 |
End posion on genome | 2000 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgatccgtgt |
tRNA gene sequence |
GGCGGGGTAGCTCAGCTGGTTAGAGCACGGGAATCATAATCCTGGGGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
agcacaacta |
Secondary structure (Cloverleaf model) | >W121065623 Met CAT t ACCA agcacaacta G + T G - C C - G G - C G - C G - C G - C T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T T A A GGGTC C - G G + T G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |