Sequence ID | >WENV063108 |
Genome ID | AACY023490312 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 874 |
End posion on genome | 952 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gtagcacgaT |
tRNA gene sequence |
CCGCCCTTAGCTCAGCTGGATAGAGCGCGGCCCTCCGGAGGCCGAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
Ttaccttttc |
Secondary structure (Cloverleaf model) | >WENV063108 Arg CCG T GCCA Ttaccttttc C - G C - G G - C C - G C - G C - G T - A T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A G AGGTC C - G G - C G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |