Sequence ID | >WENV063346 |
Genome ID | AACY023501003 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 494 |
End posion on genome | 580 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
caaaaacctT |
tRNA gene sequence |
GGGAGCGTGGTGGAATTGGTAGACGCACCGCACTCAAAATGCGGCACCTTCGGGTATGTC |
Downstream region at tRNA end position |
Taatgaatac |
Secondary structure (Cloverleaf model) | >WENV063346 Leu CAA T ACTT Taatgaatac G - C G - C G - C A - T G - C C - G G - C T G T C A G C C A T A A G | | | | | A T G G T G G T C G G C G | + | T T G A C G C T A G A CACCTTCGGGTAT C - G C - G G - C C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |