Sequence ID | >W121075495 |
Genome ID | AKAW01000006 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli O111:H8 str. CVM9634 [AKAW] |
Start position on genome | 1187 |
End posion on genome | 1111 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tcggtattct |
tRNA gene sequence |
GCGTTGTTAGCTCAGCAGGACAGAGCAATTGCCTTCTAAGCAATCGGTCACTGGTTCGAC |
Downstream region at tRNA end position |
cacttatttt |
Secondary structure (Cloverleaf model) | >W121075495 Arg TCT t GCTA cacttatttt G - C C - G G - C T - A T - A G - C T - A T C T T G A C C A C G A A | | | | | G A C T C G A C T G G C G | | | | T T G G A G C A C A A CGGTC A - T T - A T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |