Sequence ID | >W121086528 |
Genome ID | AKJZ01000040 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium sp. CF136 [AKJZ] |
Start position on genome | 198103 |
End posion on genome | 198179 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
agcaacaact |
tRNA gene sequence |
TCCTCCTTAGCTCAGTTGGTTAGAGCATCTGACTGTTAATCAGAGGGTCCTTGGTTCGAG |
Downstream region at tRNA end position |
acttttttta |
Secondary structure (Cloverleaf model) | >W121086528 Asn GTT t GCAA acttttttta T - A C - G C - G T + G C - G C - G T - A C G T G A A C C A T G A A | | | | | G T C T C G C T T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |