Sequence ID | >W121103519 |
Genome ID | AKZQ01000025 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium sp. F52 [AKZQ] |
Start position on genome | 179344 |
End posion on genome | 179268 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cctctaaacc |
tRNA gene sequence |
GGTCCTATAGCTCAGCTGGTTAGAGCACCTGACTCATAATCAGGTGGTCCCTGGTTCGAG |
Downstream region at tRNA end position |
gcaaaatcaa |
Secondary structure (Cloverleaf model) | >W121103519 Met CAT c ACTA gcaaaatcaa G - C G - C T - A C - G C - G T + G A - T C G T G G A C C A C G A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C T T A A TGGTC C - G C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |