Sequence ID | >WENV065762 |
Genome ID | AACY023612794 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 947 |
End posion on genome | 1023 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aacaaggaaT |
tRNA gene sequence |
GCCTGGGTGGTGTAACGGTTAGCACGAAAGTTTGTGGAACTTTAAGTTTGAGTTCGATTC |
Downstream region at tRNA end position |
Aaaaaatgaa |
Secondary structure (Cloverleaf model) | >WENV065762 His GTG T ACCA Aaaaaatgaa G + T C - G C - G T + G G - C G - C G - C T T T G A C T C A C A A G + | | | | G G T G T G T T G A G C G + | | | T T T G C A C T A G AAGT A - T A - T A - T G - C T - A T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |