Sequence ID | >W121112418 |
Genome ID | ALKM01000033 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas mendocina DLHK [ALKM] |
Start position on genome | 45154 |
End posion on genome | 45228 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gccgggccgg |
tRNA gene sequence |
GTCCCCTTAGTTCAACGGATAGAATAAGCCCCTCCTAAGGGCTAGATGCTGGTTCGATTC |
Downstream region at tRNA end position |
tcttcgtttc |
Secondary structure (Cloverleaf model) | >W121112418 Arg CCT g GCCA tcttcgtttc G - C T - A C - G C - G C - G C - G T - A T T T C G A C C A C A A A | | | | | G G C T T G G C T G G C G | | | + T T A G A A T T A A AGAT A - T G - C C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |