Sequence ID | >W1610000058 |
Genome ID | AABC05000008 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Ferroplasma acidarmanus fer1 [AABC] |
Start position on genome | 192031 |
End posion on genome | 191959 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tatcctctac |
tRNA gene sequence |
GGGCTCGTAGTCTAGTGGTTATGATACCGCCCTTACAAGGCGGTGATCACCGGTTCAAAT |
Downstream region at tRNA end position |
atagttagaa |
Secondary structure (Cloverleaf model) | >W1610000058 Val TAC c Attt atagttagaa G - C G - C G - C C - G T + G C - G G - C T A T T G G C C A T G A A | | | | | A G T C T G A C C G G C G | | + T T T T G A T T A A TGATC C - G C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |