| Sequence ID | >W1610000066 |
| Genome ID | AABC05000010 |
| Phylum/Class | Unclassified |
| Species | Ferroplasma acidarmanus fer1 [AABC] |
| Start position on genome | 139821 |
| End posion on genome | 139904 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
tacagtttac |
| tRNA gene sequence |
GCGGAGATTGCCGAGCTAGGAAAAGGCGATGGATTTAGGGTCCATTTCCGTAGGGATTCG |
| Downstream region at tRNA end position |
ttgttttatt |
| Secondary structure (Cloverleaf model) | >W1610000066 Leu TAG
c Atta ttgttttatt
G - C
C - G
G - C
G - C
A - T
G - C
A - T T A
T C A C C C A
T C G A T | | | | | A
A G C C G G T G G G C
G | | | T T
G A G G C
A A A G TTCCGTAGGGATTC
A - T
T - A
G - C
G - C
A - T
T G
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |