Sequence ID | >W1610000084 |
Genome ID | AACL01000001 |
Search identical group | |
Phylum/Class | Nanoarchaeota |
Species | Nanoarchaeum equitans Kin4-M [AACL] |
Start position on genome | 161947 |
End posion on genome | 162033 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
attagatact |
tRNA gene sequence |
GCGGCCGTGCCCGAGCGGTCGAAGGGGTCGGGCTTAGGACCCGATGGGTTAGTCCCGTCC |
Downstream region at tRNA end position |
taggttagca |
Secondary structure (Cloverleaf model) | >W1610000084 Leu TAG t ACTA taggttagca G - C C - G G - C G - C C - G C - G G - C T A T G C C C C A C G A G | | | | | G G G C C C C G G G G C G | | | T T T A G G G C G A G TGGGTTAGTCCCGTC T - A C - G G - C G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |