Sequence ID | >W1610000576 |
Genome ID | ABFP01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanococcus maripaludis C6 [ABFP] |
Start position on genome | 1630965 |
End posion on genome | 1630891 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
taagcaatct |
tRNA gene sequence |
GGGCCCGTAGCTTAGTCTGGTAGAGCGCCTGACTTTTAATCAGGCGGTCGAGGGTTCGAA |
Downstream region at tRNA end position |
aaaattattt |
Secondary structure (Cloverleaf model) | >W1610000576 Lys TTT t GCtc aaaattattt G - C G - C G - C C - G C - G C - G G - C T A T T T C C C A T G A A + | | | | G C T T C G G A G G G C T + | | | T T G G A G C G T A G CGGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |