Sequence ID | >W1610000598 |
Genome ID | ABHB01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanococcus voltae A3 [ABHB] |
Start position on genome | 1259450 |
End posion on genome | 1259538 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
acgttgatgT |
tRNA gene sequence |
GCAGAGATAGTCTAGCCCGGAAAGGCGTACGGCTGGAACCCGTATGAGGCTTTGCCTCTC |
Downstream region at tRNA end position |
cttttttatt |
Secondary structure (Cloverleaf model) | >W1610000598 Ser GGA T GTCA cttttttatt G - C C - G A - T G - C A - T G - C A - T T A T C C C C C A C G A A | | | | | A C T C T G G G G G G C C | | + | T T G A G G C G A A G TGAGGCTTTGCCTCTC T - A A - T C - G G - C G - C C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |