| Sequence ID | >W1610000828 |
| Genome ID | ABTZ01000001 |
| Phylum/Class | Euryarchaeota |
| Species | Halorhabdus utahensis DSM 12940 [ABTZ] |
| Start position on genome | 98601 |
| End posion on genome | 98686 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
cggatagtga |
| tRNA gene sequence |
GCCGAGGTAGCCTAGCCTGGCCAAGGCGCCTGCTTCGAGAGCAGGTCTCCTCACGGACTC |
| Downstream region at tRNA end position |
ctcacgttac |
| Secondary structure (Cloverleaf model) | >W1610000828 Ser CGA
a GCtt ctcacgttac
G - C
C - G
C - G
G - C
A - T
G - C
G - C T A
T T C C T C A
C C G A A + | | | | A
T T C C G G G G A G C
G | | | | T T
G A G G C
C C A G TCTCCTCACGGACTC
C - G
C - G
T - A
G - C
C - G
T A
T G
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |