| Sequence ID | >W1610001135 |
| Genome ID | ACQY01000004 |
| Phylum/Class | Euryarchaeota |
| Species | Methanocaldococcus infernus ME [ACQY] |
| Start position on genome | 39075 |
| End posion on genome | 39151 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
taattcccga |
| tRNA gene sequence |
GGGCCCATAGTCTAGCTGGCTATGACGCCGCCCTTACAAGGCGGAGGTCGCCGGTTCGAA |
| Downstream region at tRNA end position |
ttttttactt |
| Secondary structure (Cloverleaf model) | >W1610001135 Val TAC
a ACTA ttttttactt
G - C
G - C
G - C
C - G
C - G
C - G
A - T T A
T C G G C C A
C G A A | | | | | G
T T C T G G C C G G C
G | | | T T
G T G A C
C T A G AGGTC
C - G
C - G
G - C
C - G
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |