Sequence ID | >W1610001684 |
Genome ID | ADFG01000002 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Aciduliprofundum boonei T469 [ADFG] |
Start position on genome | 54543 |
End posion on genome | 54617 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
acttcttagc |
tRNA gene sequence |
GCCACCGTAGCTTAGCCCGGAAGAGCGGCTGACTTGTAATCAGCAGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ttctcggagc |
Secondary structure (Cloverleaf model) | >W1610001684 Thr TGT c TCtt ttctcggagc G - C C - G C - G A - T C - G C - G G - C T A T C C C C C A C G A A | | | | | G C T T C G G G G G G C C + | | | T T G G A G C G A A G AGGTC G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |