Sequence ID | >W1610001718 |
Genome ID | ADGW01000003 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Staphylothermus hellenicus DSM 12710 [ADGW] |
Start position on genome | 191586 |
End posion on genome | 191661 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gaaataacat |
tRNA gene sequence |
GGGCCCGTAGCCTAGCCAGGATAGGGCGCCGGCCTTCTAAGCCGGAGACCCGGGGTTCGA |
Downstream region at tRNA end position |
ttttgttcag |
Secondary structure (Cloverleaf model) | >W1610001718 Arg TCT t GCtg ttttgttcag G - C G - C G - C C - G C - G C - G G - C T A T G C C C C A C C G A A | | | | | G A T C C G C G G G G C G + | | | T T G G G G C A T A G AGACC C - G C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |