Sequence ID | >W1610002177 |
Genome ID | AEGP01000066 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Candidatus Nitrosarchaeum limnium limnia SFB1 [AEGP] |
Start position on genome | 15421 |
End posion on genome | 15347 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ctcatgttgt |
tRNA gene sequence |
GGGCTGGTAGTATAGCCTGGTAGTATACCCGCCTTGCACGCGGGGGGTCATGGGTTCAAA |
Downstream region at tRNA end position |
acattatatt |
Secondary structure (Cloverleaf model) | >W1610002177 Ala TGC t ACtt acattatatt G - C G - C G + T C - G T - A G - C G - C T A T T G C C C A C G A A | + | | | A C T A T G A T G G G C T + | | + T T G G T A T G T A A GGGTC C - G C - G C - G G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |