Sequence ID | >W1610002436 |
Genome ID | AELO01000028 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanobrevibacter smithii TS146C [AELO] |
Start position on genome | 72229 |
End posion on genome | 72144 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tttgtgtatT |
tRNA gene sequence |
GTCGGGATGGCCCAGCCTGGTACGGCGTCGGACTGCTAATCCGATGATCTTATGATCACA |
Downstream region at tRNA end position |
tttaatttat |
Secondary structure (Cloverleaf model) | >W1610002436 Ser GCT T GTtt tttaatttat G - C T + G C - G G - C G - C G - C A - T T A T T G C C C A C G A G | | | | | A C C C C G A C G G G C T | | | T T G C G G C G T A G TGATCTTATGATCAC T - A C - G G - C G - C A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |