| Sequence ID | >W1610004228 |
| Genome ID | AGIW01000001 |
| Phylum/Class | Thermoproteota |
| Species | Desulfurococcus amylolyticus DSM 16532 [AGIW] |
| Start position on genome | 34001 |
| End posion on genome | 33924 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
tagtatctga |
| tRNA gene sequence |
GGGGCCGTAGTCTAGCCTGGCTAGGATGCGGGGCTTGGGCCCCCGTGACCCGGGGTTCAA |
| Downstream region at tRNA end position |
ttcgtgttct |
| Secondary structure (Cloverleaf model) | >W1610004228 Pro TGG
a ACTA ttcgtgttct
G - C
G - C
G - C
G - C
C - G
C - G
G - C T A
T G C C C C A
C C G A A | | | | | A
T T C T G C G G G G C
G + | | + T T
G G G A T
C T A G TGACC
C - G
G - C
G - C
G - C
G - C
C C
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |