Sequence ID | >W1610004529 |
Genome ID | AHJG01000246 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Candidatus Nitrosarchaeum limnium limnia BG20 [AHJG] |
Start position on genome | 4774 |
End posion on genome | 4699 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tctgatcttT |
tRNA gene sequence |
GGGGACGTAGGTTAGCTTGGTATACTGCCAGCCTCGGGTGCTGGAGATCGTGGGTTCAAA |
Downstream region at tRNA end position |
tttatgaaat |
Secondary structure (Cloverleaf model) | >W1610004529 Pro CGG T ATta tttatgaaat G - C G - C G - C G - C A - T C - G G - C T A T T A C C C A C G A A + | | | | A T T T G G G T G G G C T | | + T T G T A C T G T A G AGATC C - G C - G A - T G - C C - G C T T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |