Sequence ID | >W1610004857 |
Genome ID | AHKP01000002 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanoplanus limicola DSM 2279 [AHKP] |
Start position on genome | 388452 |
End posion on genome | 388368 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
attaatcggc |
tRNA gene sequence |
GCGAGGATTGCCAAGCCCGGTCAAAGGCGCCAGGTTGAGGGCCTGGTCTTATAGAAGTTC |
Downstream region at tRNA end position |
ttcattcagg |
Secondary structure (Cloverleaf model) | >W1610004857 Leu GAG c Attt ttcattcagg G - C C - G G - C A - T G - C G - C A - T T A T C G T C C A C C G A T | | | | | G C A C C G G C A G G C G | | | T T G A G G C T C A A G TCTTATAGAAGTTC C - G C - G A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |