Sequence ID | >W1610004873 |
Genome ID | AHKP01000003 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanoplanus limicola DSM 2279 [AHKP] |
Start position on genome | 562297 |
End posion on genome | 562212 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gtataatggc |
tRNA gene sequence |
GCGAGAGTTTCCGAGTGGCCAAAGGAGCCGGACTCAAGATCCGATCTCGCAGGAGTTCGC |
Downstream region at tRNA end position |
ggttttattt |
Secondary structure (Cloverleaf model) | >W1610004873 Leu CAA c ATCA ggttttattt G - C C - G G - C A - T G - C A - T G - C T A T C G T C C A T G A T | | | | | A G G C C T G C A G G C G | | | T T C A G G A C A A G TCTCGCAGGAGTTC C A C - G G - C G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |