Sequence ID | >W1610005596 |
Genome ID | AKID01000115 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Thermococcus sp. PK [AKID] |
Start position on genome | 47706 |
End posion on genome | 47629 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aacttatcga |
tRNA gene sequence |
GGGCCGGTAGCTCAGCCTGGTTAGAGCACCGGGCTTTTAACCCGGTGGTCGCGGGTTCGA |
Downstream region at tRNA end position |
ctacaaatct |
Secondary structure (Cloverleaf model) | >W1610005596 Lys TTT a GCCA ctacaaatct G - C G - C G - C C - G C - G G - C G - C T A T T G C C C A C C G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A A TGGTC C - G C - G G - C G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |