Sequence ID | >W1610006247 |
Genome ID | AMGN01000088 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanobacterium sp. Maddingley MBC34 [AMGN] |
Start position on genome | 623 |
End posion on genome | 547 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aacttaaaat |
tRNA gene sequence |
GCCTCGGTAGCTCAGTCTGGTGGAGCGCGAGACTTGTAATCTCGTGGTCGCGGGTTCAAT |
Downstream region at tRNA end position |
aactgatgat |
Secondary structure (Cloverleaf model) | >W1610006247 Thr TGT t TCTA aactgatgat G - C C - G C - G T + G C - G G - C G - C T T T T G C C C A T G A A + | | | | A C C T C G G C G G G C T | | | | T T G G A G C G T G G TGGTC C - G G - C A - T G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |