Sequence ID | >W1610011048 |
Genome ID | AMSE01000004 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Methanomethylophilus alvi alvus Mx1201 [AMSE] |
Start position on genome | 13773 |
End posion on genome | 13687 |
Amino Acid | Pseudo |
Anticodon | GAG |
Upstream region at tRNA start position |
gaatctcagt |
tRNA gene sequence |
GCAAGGGTAGTCAAGCATGGCCAACGACGCAAGGTTGAGGGCCTTGTCCCTAGCGGTCCG |
Downstream region at tRNA end position |
atttctctaa |
Secondary structure (Cloverleaf model) | >W1610011048 Pseudo GAG t ACCA atttctctaa G - C C - G A - T A - T G - C G - C G - C T A T T G C A C A A C G A A + | | | | A T A C T G G C G T G C G | | | T T G C G A C C C A A G TCCCTAGCGGTCC C - G A - T A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |