Sequence ID | >W1610011055 |
Genome ID | AMSE01000005 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Methanomethylophilus alvi alvus Mx1201 [AMSE] |
Start position on genome | 336021 |
End posion on genome | 336095 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ctgcgtcggt |
tRNA gene sequence |
GCCACTGTGGCTCAGCGGTGGAGCGACGGTTTCGTAAACCGTTGGTCGGGGGTTCGATTC |
Downstream region at tRNA end position |
gttctaacat |
Secondary structure (Cloverleaf model) | >W1610011055 Thr CGT t TCCA gttctaacat G - C C - G C - G A - T C - G T - A G - C T T T C T C C C A G A G | + | | | G C C T C G G G G G G C G | | | | T T G G A G C T G G TGGTC A - T C - G G - C G - C T - A T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |