Sequence ID | >W1610011879 |
Genome ID | AOHV01000042 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halalkalicoccus jeotgali B3 [AOHV] |
Start position on genome | 397654 |
End posion on genome | 397573 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtcggtgtca |
tRNA gene sequence |
GCCGGGATGGCCGAACGGTAAAGCGCACGCCTGGAAAGCGTGTTCCCGTATGGGATTCTG |
Downstream region at tRNA end position |
tttcgaatta |
Secondary structure (Cloverleaf model) | >W1610011879 Ser GGA a Gtct tttcgaatta G - C C - G C - G G - C G - C G - C A - T T A T G A C C C A A A G | | | | | A C G C C G C T G G G C G | | T T G A A G C T A G TTCCCGTATGGGATT C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |