Sequence ID | >W1610011950 |
Genome ID | AOHX01000028 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Natronorubrum sulfidifaciens JCM 14089 [AOHX] |
Start position on genome | 14340 |
End posion on genome | 14267 |
Amino Acid | Pseudo |
Anticodon | GTG |
Upstream region at tRNA start position |
tgcaagcgtg |
tRNA gene sequence |
TCCGGGTTAGGGTAGTGGACTATCCTTCAGCCTTGTGGAGGCTGAGACGCGGGTTCGATT |
Downstream region at tRNA end position |
ctgcggcgaa |
Secondary structure (Cloverleaf model) | >W1610011950 Pseudo GTG g CCtt ctgcggcgaa T - A C - G C - G G - C G - C G - C T - A T T T C G C T C A T G A A | | | + | G G T G G G G C G G G C G | | + T T A T C C T C T A T AGAC C - G A - T G - C C - G C - G T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |