Sequence ID | >W1610012103 |
Genome ID | AOIA01000167 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Natronococcus jeotgali DSM 18795 [AOIA] |
Start position on genome | 95987 |
End posion on genome | 95916 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cggatacgaa |
tRNA gene sequence |
GCGCGGTTGGTCCAGCGGTAGGACAGCTGCCTCCCACGCAGCTAGCCCGGGTTCAAATCC |
Downstream region at tRNA end position |
ttgacggagc |
Secondary structure (Cloverleaf model) | >W1610012103 Gly CCC a ACtt ttgacggagc G - C C - G G - C C - G G - C G - C T - A T A T G G C C C A G A G | | | | | A C C C T G C C G G G C G | | | | T T G G G A C T A A TAGC G - C C - G T - A G - C C - G C C T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |