Sequence ID | >W1610012178 |
Genome ID | AOIC01000087 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Natronobacterium gregoryi SP2 [AOIC] |
Start position on genome | 41977 |
End posion on genome | 41892 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgggacgccT |
tRNA gene sequence |
GCGAGGGTAGCCAAGCGGTCAACGGCGGCGGACTCAAGATCCGCTCGTGTAGACGTTCGT |
Downstream region at tRNA end position |
cagtgaggca |
Secondary structure (Cloverleaf model) | >W1610012178 Leu CAA T ATCg cagtgaggca G - C C - G G - C A - T G - C G - C G - C T T T C T C C C A C G A A | | | | G G A C C G G T G G G C G | | | T T T C G G C C A A G TCGTGTAGACGTTC G - C C - G G - C G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |