Sequence ID | >W1610012496 |
Genome ID | AOIN01000008 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Natrialba chahannaoensis JCM 10990 [AOIN] |
Start position on genome | 136276 |
End posion on genome | 136352 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttccggatac |
tRNA gene sequence |
GGGCTCGTGGTCTAGCTGGTTATGACGCGGCCTTTACAAGGCCGAGGTCGGTGGTTCGAA |
Downstream region at tRNA end position |
ctcctctgca |
Secondary structure (Cloverleaf model) | >W1610012496 Val TAC c ACTA ctcctctgca G - C G - C G - C C - G T - A C - G G - C C A T C C G C C A C G A G | | + | | G T T C T G G G T G G C G | | | T T G T G A C T T A G AGGTC C - G G - C G - C C - G C - G T A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |