Sequence ID | >W1610012569 |
Genome ID | AOIO01000038 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Natrialba asiatica DSM 12278 [AOIO] |
Start position on genome | 70102 |
End posion on genome | 70176 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttccggatgc |
tRNA gene sequence |
GGGCTCGTGGTCTAGCTGGTCATGACGCGGCCTTTACAAGGCCGAGGTCGGTGGTTCGAA |
Downstream region at tRNA end position |
cctgctgcga |
Secondary structure (Cloverleaf model) | >W1610012569 Val TAC c ACtt cctgctgcga G - C G - C G - C C - G T - A C - G G - C C A T C C G C C A C G A G | | + | | G T T C T G G G T G G C G | | | T T G T G A C T C A G AGGTC C - G G - C G - C C - G C - G T A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |