Sequence ID | >W1610012581 |
Genome ID | AOIP01000003 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Natrialba aegyptia DSM 13077 [AOIP] |
Start position on genome | 5643 |
End posion on genome | 5569 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tgaaaccacg |
tRNA gene sequence |
GGGCCGGTAGCTCAGTCTGGCAGAGCGTCTGGCTTTTAACCAGACGGTCGCGTGTTCAAA |
Downstream region at tRNA end position |
ttgcttcgag |
Secondary structure (Cloverleaf model) | >W1610012581 Lys TTT g GCtt ttgcttcgag G - C G - C G - C C - G C - G G - C G - C T A T C G C G C A T G A A | | | + | A C C T C G G C G T G C T | | | | T T G G A G C G C A G CGGTC T - A C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |