Sequence ID | >W1610012608 |
Genome ID | AOIP01000031 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Natrialba aegyptia DSM 13077 [AOIP] |
Start position on genome | 337592 |
End posion on genome | 337677 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gagacacggT |
tRNA gene sequence |
GTCGTGGTAGCCAAGCGGCCCAAGGCGCATGGTTGCTAACCATGTGGCGTCAAGCCTCCG |
Downstream region at tRNA end position |
gatacccgag |
Secondary structure (Cloverleaf model) | >W1610012608 Ser GCT T GTCg gatacccgag G - C T - A C - G G - C T - A G - C G - C T A T G C C C C A C G A A | | | | | A G A C C G C G G G G C G | | | T T C A G G C C C A G TGGCGTCAAGCCTC C - G A - T T - A G - C G - C T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |