Sequence ID | >W1610013002 |
Genome ID | AOJE01000060 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum saccharovorum DSM 1137 [AOJE] |
Start position on genome | 84800 |
End posion on genome | 84875 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cctgaatcga |
tRNA gene sequence |
GCCGAAGTAGCTCAGTTGGTAGAGCGCCTCGCTGTTAACGAGGCGGTCCCAGGTTCGAGT |
Downstream region at tRNA end position |
ctttccgttt |
Secondary structure (Cloverleaf model) | >W1610013002 Asn GTT a GCCT ctttccgttt G - C C - G C - G G - C A - T A - T G - C T G T G G T C C A T G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C T A G CGGTC C - G C - G T - A C - G G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |