Sequence ID | >W1610013653 |
Genome ID | AOLH01000002 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloferax lucentense DSM 14919 [AOLH] |
Start position on genome | 142104 |
End posion on genome | 142188 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gacacagcga |
tRNA gene sequence |
GCGTGGGTAGCCAAGCCAGGCCAACGGCGCAGCGTTGAGGGCGCTGTCCTGTAGAGGTCC |
Downstream region at tRNA end position |
caagatgcag |
Secondary structure (Cloverleaf model) | >W1610013653 Leu GAG a Atcg caagatgcag G - C C - G G - C T - A G - C G - C G - C T A T T G G C C A C C G A A + | | | | A A A C C G G C C G G C G | | | T T G C G G C C C A A G TCCTGTAGAGGTCC C - G A - T G - C C - G G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |