Sequence ID | >W1610013847 |
Genome ID | AOLK01000023 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloferax elongans ATCC BAA-1513 [AOLK] |
Start position on genome | 251503 |
End posion on genome | 251573 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gaagcgaagc |
tRNA gene sequence |
GCGCCGATGGTCCAGTGGTAGGACACGAGCTTCCCAAGCTCGAAGCCCGGGTTCAATTCC |
Downstream region at tRNA end position |
ctgtcgaacg |
Secondary structure (Cloverleaf model) | >W1610013847 Gly CCC c Attt ctgtcgaacg G - C C - G G - C C - G C - G G - C A - T T T T G G C C C A G A G | | | | | A T C C T G C C G G G C G | | | | T T G G G A C T A A AAGC C - G G - C A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |