Sequence ID | >W1610014202 |
Genome ID | AOLR01000066 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloarcula sinaiiensis ATCC 33800 [AOLR] |
Start position on genome | 3232 |
End posion on genome | 3158 |
Amino Acid | Pseudo |
Anticodon | TTT |
Upstream region at tRNA start position |
actatattcc |
tRNA gene sequence |
GGGCTCGGGGCCTATGAGGCACAGGCGTGGGACTTTTAATCCCGAGACAGAGGGTTCGAA |
Downstream region at tRNA end position |
gcatccgttc |
Secondary structure (Cloverleaf model) | >W1610014202 Pseudo TTT c GCtc gcatccgttc G - C G - C G - C C - G T - A C - G G - C T A G C T C C C A G T A G | | | | | G A T C C G G A G G G C G | | | | T T G A G G C C A C G AGACA T + G G - C G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |