Sequence ID | >W1610014260 |
Genome ID | AOLW01000007 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloarcula amylolytica JCM 13557 [AOLW] |
Start position on genome | 108540 |
End posion on genome | 108467 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ggtggcatac |
tRNA gene sequence |
GGGTCCGTGGTCTAGTTGGTTATGACGTGGCCTTTACAAGGCCGAGGCCGGTGGTTCGAA |
Downstream region at tRNA end position |
tgcgacgaac |
Secondary structure (Cloverleaf model) | >W1610014260 Val TAC c Atcc tgcgacgaac G - C G - C G - C T - A C - G C - G G - C T A T C C G C C A T G A G | | + | | G T T C T G G G T G G C G | | | T T G T G A C T T A G AGGCC T + G G - C G - C C - G C - G T A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |