Sequence ID | >W1610018021 |
Genome ID | APJZ01000002 |
Search identical group | |
Phylum/Class | Nanoarchaeota |
Species | Candidatus Nanobsidianus stetteri Nst1 [APJZ] |
Start position on genome | 96619 |
End posion on genome | 96546 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ttatattttT |
tRNA gene sequence |
GGGCCCGTAGTCTAGTGGTAGGATTCTGGCCTCGCTAGCCAGAGGTCCCGGGTTCAAGTC |
Downstream region at tRNA end position |
atttatatta |
Secondary structure (Cloverleaf model) | >W1610018021 Ala CGC T AGat atttatatta G - C G - C G + T C - G C - G C - G G - C T G T G G C C C A G A A | | | | | A T T C T G C C G G G C G + | | + T T G G G A T T A T AGGTC C - G T - A G - C G - C C - G C A T T C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |