| Sequence ID | >W1610018603 |
| Genome ID | AQTC01000059 |
| Phylum/Class | Thermoproteota |
| Species | Crenarchaeota archaeon SCGC AAA471-C03 [AQTC] |
| Start position on genome | 32067 |
| End posion on genome | 32142 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
gtaattagaT |
| tRNA gene sequence |
GCCCTGGTAGTTTAGCCCGGTTAGAATGTGAGGCTGTCACCCTTGAGGCCCGGGTTCAAA |
| Downstream region at tRNA end position |
attattttat |
| Secondary structure (Cloverleaf model) | >W1610018603 Asp GTC
T GTtc attattttat
G - C
C - G
C - G
C - G
T - A
G - C
G - C T A
T G G C C C A
C C G A A | | | | | A
C T T T G C C G G G C
G + | | + T T
G G A A T
T T A G AGGC
T + G
G + T
A - T
G - C
G - C
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |