Sequence ID | >W1610018877 |
Genome ID | AQXV01000015 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanothermococcus thermolithotrophicus DSM 2095 [AQXV] |
Start position on genome | 9774 |
End posion on genome | 9846 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ctatagcgtg |
tRNA gene sequence |
GCCGGGGTGGGGTAGTGGCTATCCTGGGGGACTGTGGATCCCCTGACCCGGGTTCGATTC |
Downstream region at tRNA end position |
ttactttttt |
Secondary structure (Cloverleaf model) | >W1610018877 His GTG g CCtt ttactttttt G - C C - G C - G G - C G - C G - C G + T T T T G G C C C A T G A G | | | | | G G T G G G C C G G G C G | | + T T C T C C T T A G TGAC G - C G - C G - C G - C A - T C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |