Sequence ID | >W1610018929 |
Genome ID | AQYM01000028 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Crenarchaeota archaeon SCGC AAA471-B05 [AQYM] |
Start position on genome | 42431 |
End posion on genome | 42508 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
aaagaaaaaT |
tRNA gene sequence |
GCCTCGGTAGTTTAGCCTGGTTAAGAATGTAGGCCTCTCAAGCCTAAGATCCCGGGTTCA |
Downstream region at tRNA end position |
attttttata |
Secondary structure (Cloverleaf model) | >W1610018929 Glu CTC T ATaa attttttata G - C C - G C - G T - A C - G G - C G - C T A T G G C C C A C C G A A | | | | | A T T T T G C C G G G C G + | | + T T G G A A T T T A A G AGATC T - A A - T G - C G - C C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |