Sequence ID | >W1610018952 |
Genome ID | AQYW01000049 |
Search identical group | |
Phylum/Class | Nanoarchaeota |
Species | Nanoarchaeota archaeon SCGC AAA011-L22 [AQYW] |
Start position on genome | 171 |
End posion on genome | 97 |
Amino Acid | Pseudo |
Anticodon | GGG |
Upstream region at tRNA start position |
ataattccga |
tRNA gene sequence |
GGGGCTGTTGTATAGGTTGGTCTATTATTGGCGCTTGGGGTGCGTCAGACCCAGGTTCAA |
Downstream region at tRNA end position |
attaaatatt |
Secondary structure (Cloverleaf model) | >W1610018952 Pseudo GGG a Atct attaaatatt G - C G + T G - C G - C C - G T - A G - C T A T G G T C C A T G G A T | | | | | A T T A T G C C A G G C G | | + T T G T T A T T C T A T AGAC G - C G + T C - G G - C C - G T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |