Sequence ID | >W1610018991 |
Genome ID | AQZY01000012 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halomicrobium katesii DSM 19301 [AQZY] |
Start position on genome | 69388 |
End posion on genome | 69461 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gtatgcccgc |
tRNA gene sequence |
GCCGGTGTAGCTCAGACTGGCAGAGCGAATCCTTCGTAAGGATTAGGCCGAGGGTTCAAA |
Downstream region at tRNA end position |
ccttctcggt |
Secondary structure (Cloverleaf model) | >W1610018991 Thr CGT c Ttcc ccttctcggt G - C C - G C - G G - C G - C T - A G - C T A T C T C C C A A G A A | | | | | A C C T C G G A G G G C T | | | | T T G G A G C G C A G AGGCC A - T A - T T - A C - G C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |